Hacker News Day

Air Canada to remove free carry-on from basic economy (loyaltylobby.com)

46 points by lxm posted 6 hours ago • 100 comments

Lossless Log Aggregation - Reduce Log Volume by 99% Without Dropping Data (bit.kevinslin.com)

46 points by benshumaker posted 6 hours ago • 26 comments

Why housing shortages cause homelessness (worksinprogress.co)

45 points by apsec112 posted 5 hours ago • 66 comments

The lobbist who hijacked ~3% of revenue from US doctors (propublica.org)

38 points by IG_Semmelweiss posted 6 hours ago • 6 comments

There Are No More Dogs in Antarctica (chrisdobo.com)

28 points by thunderbong posted 3 hours ago • 21 comments

Anthem BCBS calls off surgery anesthesia cap after UH CEO murdered (axios.com)

25 points by TaurenHunter posted 4 hours ago • 4 comments

NYC votes to approve City of Yes upzoning plan (abc7ny.com)

24 points by apsec112 posted 5 hours ago • 6 comments

Health Insurance Companies Take Down Leadership Pages Following Murder of UH CEO (404media.co)

20 points by vector_spaces posted 4 hours ago • 11 comments

Gordon Letwin OS/2 Usenet post (1995) (gunkies.org)

19 points by walterbell posted 2 hours ago • 9 comments

Ask HN: What companies have a good work life balance?

16 points by smaug7 posted 6 hours ago • 6 comments

Elon Musk Spent over $250M to Help Elect Trump (nytimes.com)

15 points by breadwinner posted 3 hours ago • 4 comments

US life expectancy, currently 49th, expected to fall to 66th by 2050 (cnn.com)

14 points by hilux posted 4 hours ago • 9 comments

Talking with strangers is surprisingly informative (2022) (pnas.org)

14 points by Natfan posted 6 hours ago • 1 comments

Dangerous Things Sells “Cybernetic Microchip Biohacking” RFID and NFC Implants (dangerousthings.com)

14 points by KincadeHoney posted 7 hours ago • 19 comments

How to Pronounce Chinese Names a Little Better (jacko.io)

12 points by oconnor663 posted 4 hours ago • 1 comments

Roaming RAG – Make the Model Find the Answers (arcturus-labs.com)

12 points by JnBrymn posted 6 hours ago • 2 comments

Donald Trump Names David Sacks as White House AI and Crypto Czar (bloomberg.com)

11 points by kjhughes posted 4 hours ago • 3 comments

Trump appoints former PayPal COO David Sacks as AI and crypto czar (reuters.com)

11 points by TheAlchemist posted 6 hours ago

Anaesthesiologists and Surprise Billing (twitter.com)

10 points by apsec112 posted 4 hours ago • 2 comments

dtrace.conf(24) (oxide.computer)

10 points by bcantrill posted 6 hours ago • 1 comments

Linus Torvalds Comes Out Against "Completely Broken" x86_64 Feature Levels (phoronix.com)

9 points by mfiguiere posted 6 hours ago

Forensic Methodology to Catch NSO Group's Pegasus Spyware (amnesty.org)

9 points by car posted 6 hours ago • 1 comments

HarmonyOS Next gets container tool to run Android applications (osnews.com)

8 points by rguiscard posted 6 hours ago • 1 comments

The Developing World Is Buying $180k E-Buses on the Cheap (bloomberg.com)

7 points by toomuchtodo posted 3 hours ago • 1 comments

Calypso: CalDAV/CardDAV server using Git to retain database history (keithp.com)

7 points by JNRowe posted 4 hours ago

Advanced OAuth2: Refresh Tokens and Token Expiration Strategies (igventurelli.io)

6 points by mooreds posted 6 hours ago

Beef fat prevents alcoholic liver disease in the rat (pubmed.ncbi.nlm.nih.gov)

6 points by typeofhuman posted 7 hours ago • 4 comments

Amnesty concludes Israel is committing genocide in Gaza (amnesty.org)

5 points by zhengiszen posted 3 hours ago

FDA Heads to Court to Defend Decision Protecting Drug Monopoly from Competition (hntrbrk.com)

5 points by impish9208 posted 4 hours ago

Assassination Is a Leaky Abstraction (coldwaters.substack.com)

5 points by drc500free posted 6 hours ago

Recent global temperature surge intensified by record-low planetary albedo (science.org)

5 points by Jimmc414 posted 6 hours ago

TagEnergy to build France's largest battery, 240MW/480MWh (ess-news.com)

5 points by gnabgib posted 6 hours ago • 1 comments

"AI pimping" accounts are exploding on social media (marketplace.org)

4 points by toomuchtodo posted 4 hours ago

Canada adds more than 300 assault-style firearms to list of banned weapons (cbc.ca)

4 points by geox posted 6 hours ago • 1 comments

University of Michigan eliminates DEI statements as part of faculty hiring (cbsnews.com)

3 points by nsoonhui posted 2 hours ago

A Confederacy of Models: A Comprehensive Evaluation of LLMs on Creative Writing (aclanthology.org)

3 points by handfuloflight posted 4 hours ago

PaliGemma 2: Powerful Vision-Language Models, Simple Fine-Tuning (developers.googleblog.com)

167 points by meetpateltech posted 13 hours ago • 19 comments

Gitlab names Bill Staples as new CEO (businesswire.com)

164 points by tolerable posted 9 hours ago • 135 comments

Show HN: Replace "hub" by "ingest" in GitHub URLs for a prompt-friendly extract (gitingest.com)

163 points by cyclotruc posted 16 hours ago • 43 comments

McKinsey unit will pay $123M to settle claims it bribed South African officials (cnbc.com)

155 points by donsupreme posted 11 hours ago • 103 comments

VectorChord: Store 400k Vectors for $1 in PostgreSQL (blog.pgvecto.rs)

154 points by gaocegege posted 1 day ago • 40 comments

Congo gov. says it's 'on alert' over mystery flu-like disease that killed dozens (ctvnews.ca)

140 points by amichail posted 11 hours ago • 64 comments

HowStuffWorks founder Marshall Brain sent final email before sudden death (arstechnica.com)

139 points by CharlesW posted 1 day ago • 46 comments

An Interview with Bill Watterson (1987) (timhulsizer.com)

128 points by thunderbong posted 14 hours ago • 73 comments

I spent a year building an Android course for the elderly (kopiascsaba.hu)

126 points by kcsaba2 posted 12 hours ago • 44 comments

Boeing plea deal over fatal 737 MAX crashes rejected by judge (bloomberg.com)

124 points by impish9208 posted 13 hours ago • 125 comments

Message order in Matrix: right now, we are deliberately inconsistent (artificialworlds.net)

122 points by whereistimbo posted 1 day ago • 87 comments

AmpereOne: Cores Are the New MHz (jeffgeerling.com)

121 points by speckx posted 13 hours ago • 81 comments

Americans React to UnitedHealthcare CEO's Murder: 'My Empathy Is Out of Network' (gizmodo.com)

109 points by pseudolus posted 19 hours ago • 227 comments

US Senators implore Department of Defense to expand the use of Matrix (element.io)

101 points by neiljohnson posted 20 hours ago • 34 comments

Torrent of Hate for Health Insurance Industry Follows CEO's Killing (nytimes.com)

94 points by jbrot posted 8 hours ago • 242 comments

Bitcoin price hits $100K for first time in history (cointelegraph.com)

92 points by cannibalXxx posted 21 hours ago • 140 comments

The "simple" 38 step journey to getting an RFC (blog.benjojo.co.uk)

88 points by greyface- posted 19 hours ago • 19 comments

Healthcare companies are yanking info from their leadership pages (old.reddit.com)

87 points by paganel posted 8 hours ago • 108 comments

Researchers get 'compact' hard X-ray machine to work (tue.nl)

87 points by afyzendo posted 9 hours ago • 19 comments

UnitedHealth's Playbook for Limiting Mental Health Coverage (propublica.org)

87 points by cratermoon posted 1 day ago • 20 comments

How to pack ternary numbers in 8-bit bytes (compilade.net)

81 points by todsacerdoti posted 15 hours ago • 58 comments

Chocolate intake and risk of type 2 diabetes: prospective cohort studies (bmj.com)

76 points by gnabgib posted 12 hours ago • 76 comments

macOS Packaging for Ungoogled-Chromium (github.com)

72 points by keepamovin posted 21 hours ago • 95 comments

Jury Nullification (en.wikipedia.org)

70 points by amarcheschi posted 10 hours ago • 25 comments

FreeBSD OCI Container on Jails/Bhyve with Support for Podman (freebsdfoundation.org)

64 points by BSDobelix posted 11 hours ago • 9 comments

Moderators Delete Reddit Thread as Doctors Torch Dead UnitedHealthcare CEO (thedailybeast.com)

62 points by truegoric posted 11 hours ago • 56 comments

Bitcoin is over $100k (tradingview.com)

61 points by WheelsAtLarge posted 1 day ago • 69 comments

Exploring inference memory saturation effect: H100 vs. MI300x (dstack.ai)

52 points by latchkey posted 14 hours ago • 10 comments

cli53 – Command line tool for Amazon Route 53 (github.com)

51 points by indigodaddy posted 15 hours ago • 5 comments

OpenAI confirms new $200 monthly subscription, ChatGPT Pro (techcrunch.com)

50 points by gniting posted 13 hours ago • 25 comments

The Acton Programming Language (acton-lang.org)

47 points by todsacerdoti posted 9 hours ago • 28 comments

Surgeon General says loneliness is driving US into anxiety and pessimism (bubblic.app)

44 points by jaybhum posted 13 hours ago • 93 comments

Why overplanning makes projects fail? (sanju.sh)

40 points by spikey_sanju posted 12 hours ago • 27 comments

More than 300 game developers lost their jobs in one day, weeks before Christmas (pcgamer.com)

36 points by jarsin posted 15 hours ago • 76 comments

Memory is all we have (onepercentrule.substack.com)

33 points by drcwpl posted 11 hours ago • 11 comments

Akamai Remembers Danny Lewin (akamai.com)

32 points by shahargl posted 22 hours ago • 2 comments

Wubuntu: The lovechild of Windows and Linux nobody asked for (theregister.com)

29 points by LorenDB posted 19 hours ago • 36 comments

US LLCs must file new report with Treasury FinCEN or risk prison (fincen.gov)

28 points by ruffrey posted 14 hours ago • 32 comments

All of Google Offline?

28 points by gadtfly posted 21 hours ago • 23 comments

Uber Stock Down 10% Because Waymo Is Expanding to Florida (barrons.com)

27 points by donsupreme posted 10 hours ago • 3 comments

60k people deactivated their X accounts on average each day in one week alone (londonherald.co.uk)

24 points by doener posted 18 hours ago • 41 comments

How close is AI to human-level intelligence? (nature.com)

24 points by ororm posted 20 hours ago • 64 comments

AggiesBCI – brain-controlled wheelchair converts thoughts to real-world movement (yusiali.com)

22 points by pabs3 posted 1 day ago • 6 comments

USB-C cable CT scan reveals sinister active electronics (tomshardware.com)

21 points by toss1 posted 9 hours ago • 6 comments

Tesla shuts down Cybertruck production for days at critical time for the company (electrek.co)

21 points by tedd4u posted 15 hours ago • 17 comments

End of Hachette vs. Internet Archive (blog.archive.org)

20 points by jzb posted 11 hours ago • 1 comments

Ask HN: Did Google/Alphabet ever try to build a Starlink?

20 points by govideo posted 1 day ago • 48 comments

Ask HN: What AI tools changed your work/life?

19 points by divan posted 16 hours ago • 14 comments

Day after nuclear power vow Meta announces largest-ever fossil fueled datacenter (theregister.com)

18 points by rntn posted 8 hours ago • 1 comments

DOJ Finds Civil Rights Violations by Police Department and City of Memphis (justice.gov)

18 points by gnabgib posted 10 hours ago • 1 comments

Amnesty International says sufficient evidence to accuse Israel of genocide (cnn.com)

18 points by okasaki posted 12 hours ago

The Guy Who Bought (and Ate) That Banana Art Is a Dangerous Criminal (slate.com)

16 points by rntn posted 9 hours ago • 2 comments

Reclaim the internet: Mozilla's rebrand for the next era of tech (blog.mozilla.org)

16 points by Zariff posted 17 hours ago • 7 comments

Diamonds are forever? World-first carbon-14 diamond battery made (gov.uk)

16 points by miles posted 1 day ago • 13 comments

Indian state bans eating beef in public (bbc.com)

15 points by impish9208 posted 20 hours ago • 12 comments

Over 21000 Workers Reported Dead in Saudi Arabia's NEOM Project (sand-boarding.com)

15 points by uprootdev posted 1 day ago • 5 comments

Dog domestication happened many times, but most didn't pan out (arstechnica.com)

15 points by rntn posted 1 day ago

Putin Decides That Stalin's Victims Were Guilty After All (theatlantic.com)

14 points by peutetre posted 9 hours ago • 5 comments

Big Insurer Sets Time Limits on Anesthesia Coverage During Surgeries (levernews.com)

14 points by speckx posted 1 day ago • 3 comments

US West Coast Tsunami Warning (tsunami.gov)

13 points by stanlem posted 12 hours ago • 1 comments

Amazon sued over slower deliveries to low-income neighborhoods (cbsnews.com)

13 points by erehweb posted 1 day ago • 1 comments

Ask HN: How is the M4 MacBook Pro Nano-texture screen for long coding so far?

12 points by imbnwa posted 10 hours ago • 5 comments

Mozilla Foundation crumbles as third of staff cast off (theregister.com)

12 points by urlwolf posted 14 hours ago • 3 comments

Billionaire who performed the first private spacewalk is picked to lead NASA (apnews.com)

12 points by josephwegner posted 19 hours ago • 3 comments

NATO tests aquatic drones to protect cables, coastlines (theregister.com)

12 points by sandwichsphinx posted 1 day ago • 1 comments

LA Times Owner Personally Reviews Opinion Headlines to Avoid Offending Elon Musk (techdirt.com)

11 points by hn_acker posted 8 hours ago • 1 comments

How One of the Richest Men Is Avoiding $8B in Taxes (nytimes.com)

11 points by wslh posted 9 hours ago • 4 comments

Show HN: Checkmate, a server and infrastructure monitoring application (github.com)

11 points by gorkemcetin posted 10 hours ago • 1 comments

A16Z 2025 Big Ideas for Crypto (a16zcrypto.com)

11 points by wslh posted 14 hours ago • 9 comments

Police illegally sell restricted weapons, supplying crime (cbsnews.com)

11 points by coloneltcb posted 17 hours ago • 1 comments

Disposable Python environments for ad-hoc analyses (ericmjl.github.io)

11 points by sebg posted 18 hours ago • 4 comments

Show HN: Self Hosted AI Server Gateway for Ollama, ComfyUI and FFmpeg Servers (openai.servicestack.net)

11 points by mythz posted 18 hours ago

UK uncovers crypto laundering scheme for gangsters and Russian spies (ft.com)

11 points by cannibalXxx posted 21 hours ago • 1 comments

Valve dev fixes 3D lighting, exposes flawed graphics card math (pcgamer.com)

11 points by xbmcuser posted 1 day ago • 2 comments

I am so sick of subscriptions for AI products

10 points by hitsy00 posted 9 hours ago • 5 comments

Threat to claw back Rivian loan sparks criticism of Musk's conflict of interest (cnn.com)

10 points by peutetre posted 9 hours ago • 1 comments

Asleep at the Wheel in the Headlight Brightness Wars (theringer.com)

10 points by Syonyk posted 11 hours ago • 5 comments

DSQL Vignette: Transactions and Durability (brooker.co.za)

10 points by qianli_cs posted 12 hours ago

Anthem Blue Cross Blue Shield says it won't cover anesthesia after time limit (today.com)

10 points by SlightlyLeftPad posted 14 hours ago • 5 comments

US officials recommend encrypted messaging to evade hackers in telecom networks (theverge.com)

10 points by zephyreon posted 17 hours ago • 1 comments

The Satellite That Could Change the World (nytimes.com)

10 points by vo2maxer posted 21 hours ago • 2 comments

A New Phone Scanner That Detects Spyware Has Found 7 Pegasus Infections (wired.com)

9 points by lxm posted 8 hours ago • 1 comments

Show HN: Data Connector – Chat with Your Database and APIs (github.com)

9 points by johnjcsmith posted 8 hours ago

The return of Steam Machines? Valve rolls out new "Powered by SteamOS" branding (arstechnica.com)

9 points by AndrewDucker posted 11 hours ago

Amnesty accuses Israel of genocide against Palestinians in Gaza (bbc.com)

9 points by tacheiordache posted 14 hours ago • 2 comments

Worst US hack in history: Chinese can monitor all your calls and emails (tuta.com)

9 points by donohoe posted 15 hours ago • 1 comments

I could tell which college admissions essays were written by ChatGPT (old.reddit.com)

9 points by EvgeniyZh posted 15 hours ago

OpenAI Continues Mission of 'Ethical' AI by Partnering with Killer Robot Company (gizmodo.com)

9 points by pseudolus posted 17 hours ago • 2 comments

Russian teenagers are being locked up for expressing dissent (cnn.com)

9 points by peutetre posted 18 hours ago • 1 comments

Bitcoin Surges Past $100k (forbes.com)

9 points by GBiT posted 23 hours ago

Social Media Has Little Sympathy for Murdered Health Insurance Exec (rollingstone.com)

8 points by wumeow posted 14 hours ago • 6 comments

The Coming Bifurcation of the Web: AgentWeb vs. ArtisanWeb (mantcz.com)

8 points by mantcz posted 16 hours ago • 2 comments

He Was Going to Save Intel. He Destroyed $150B of Value Instead (wsj.com)

8 points by impish9208 posted 16 hours ago • 6 comments

What's up with Lobste.rs blocking the Brave browser? (lobste.rs)

8 points by waon posted 23 hours ago • 2 comments

Ask HN: How do you manage your AI prompts?

8 points by siddharthgoel88 posted 1 day ago • 2 comments

China Announces a Ban on Rare Minerals to the U.S. (msn.com)

8 points by paulpauper posted 1 day ago

US judge rejects Boeing 737 MAX accord over diversity policies (france24.com)

7 points by thefounder posted 8 hours ago • 2 comments

Court: Warrantless Searches of an Immigration Lawyer's Phone Are Constitutional (techdirt.com)

7 points by hn_acker posted 8 hours ago • 1 comments

OpenAI teases 12 days of mystery product launches starting tomorrow (arstechnica.com)

7 points by Brajeshwar posted 16 hours ago

Tell HN: Tonic (.to registrar) took away my domain without notice

7 points by bkfh posted 21 hours ago • 5 comments

Orbit of a Possible Planet X (cosmosmagazine.com)

6 points by geox posted 12 hours ago • 1 comments

Nun arrested over suspected mafia links (news.sky.com)

6 points by austinallegro posted 14 hours ago • 1 comments

DC Sues Amazon for 'Secretly' Excluding Zip Codes from Prime Delivery Benefits (oag.dc.gov)

6 points by ivewonyoung posted 16 hours ago • 3 comments

Spies jumped from one telco to another in a way 'I've not seen in my career' (theregister.com)

6 points by LinuxBender posted 17 hours ago

UnitedHealth data breach leaked info on over 100M people (theverge.com)

6 points by croes posted 17 hours ago

CVS, UnitedHealth, Cigna sue to block FTC case over insulin prices (cnbc.com)

6 points by croes posted 17 hours ago

Ask HN: Devs, where to start in robotic field?

6 points by sawirricardo posted 19 hours ago

The brain microbiome: could understanding it help prevent dementia? (theguardian.com)

6 points by pseudolus posted 20 hours ago

Claude 3.5 helped me fight off a $10k rental car damage claim – and won (old.reddit.com)

6 points by gronky_ posted 1 day ago

Humane wants to put the AI Pin's software inside your phone, car, and speaker (theverge.com)

6 points by ajuhasz posted 1 day ago • 2 comments

New Android spyware found on phone seized by Russian FSB (bleepingcomputer.com)

5 points by elpocko posted 14 hours ago

Project Titan Sample Game is now available: explore this huge open world (unrealengine.com)

5 points by robaato posted 14 hours ago

Sam Altman sure hopes someone figures out how not to destroy humanity (cnn.com)

5 points by zzzeek posted 14 hours ago • 5 comments

Zen of Batch Pipelines – A recipe to reduce cognitive load (ragulpr.github.io)

5 points by ragulpr posted 14 hours ago

The UC Berkeley Project That Is the AI Industry's Obsession (wsj.com)

5 points by t23 posted 15 hours ago • 2 comments

U.S. House Subcommittee releases comprehensive Covid-19 pandemic review [pdf] (oversight.house.gov)

5 points by Kerbiter posted 15 hours ago • 2 comments

Product management is broken. Engineers can fix it (newsletter.posthog.com)

5 points by hollowdene posted 17 hours ago • 1 comments

Bitcoin Hits a Milestone: $100k (nytimes.com)

5 points by gautamcgoel posted 1 day ago • 1 comments

Trump nominates Jared Isaacman to become the next NASA administrator (arstechnica.com)

5 points by freeqaz posted 1 day ago • 1 comments

Propaganda of the Deed (en.wikipedia.org)

5 points by dredmorbius posted 1 day ago

Japan: Early career setbacks reduce marriage and birth rates (population.fyi)

5 points by amichail posted 1 day ago

Terabit-scale high-fidelity diamond data storage (nature.com)

4 points by westurner posted 11 hours ago • 3 comments

Vodka maker Stoli says August ransomware attack contributed to bankruptcy filing (therecord.media)

4 points by aa_is_op posted 16 hours ago

How to Live in a Collapsing Economy (youtube.com)

4 points by razodactyl posted 19 hours ago

TP-Link cannot get IPv6 firewall right (sim642.eu)

4 points by dajoh posted 19 hours ago • 5 comments

The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA (english.elpais.com)

4 points by marban posted 1 day ago

A New Phone Scanner That Detects Spyware Has Found 7 Pegasus Infections (wired.com)

4 points by thunderbong posted 1 day ago

Chawan: A web browser for your terminal (sr.ht)

3 points by fanf2 posted 15 hours ago

OpenAI, Anthropic Expand in Europe with Zurich Offices (wsj.com)

3 points by eamag posted 16 hours ago

Gyrobus: A Bus Powered by a Flywheel (en.wikipedia.org)

3 points by busfahrer posted 22 hours ago

Zep AI (YC W24) Is Hiring a Dev Advocate (ycombinator.com)

1 points by roseway4 posted 10 hours ago

Keye (YC F24) Is Hiring – Senior Software Engineer

1 points by lalitlal posted 13 hours ago

Humanloop (YC S20) Is Hiring Product Engineers in London and SF (humanloop.com)

1 points by jordn posted 19 hours ago

Show HN: I combined spaced repetition with emails so you can remember anything (ginkgonotes.com)

232 points by iskrataa posted 1 day ago • 83 comments

AI helps researchers dig through old maps to find lost oil and gas wells (newscenter.lbl.gov)

228 points by gnabgib posted 1 day ago • 102 comments

Grifters, believers, grinders, and coasters (seangoedecke.com)

222 points by rbanffy posted 1 day ago • 118 comments

No NAT November: My month without IPv4 (blog.infected.systems)

217 points by LinuxBender posted 2 days ago • 154 comments

Formaldehyde Causes More Cancer Than Any Other Toxic Air Pollutant (propublica.org)

211 points by hn_acker posted 2 days ago • 134 comments

UnitedHealthcare CEO fatally shot in midtown Manhattan (cnn.com)

199 points by sonabinu posted 1 day ago • 383 comments

AI hallucinations: Why LLMs make things up (and how to fix it) (kapa.ai)

184 points by emil_sorensen posted 1 day ago • 237 comments

Nearly half of teenagers globally cannot read with comprehension (ourworldindata.org)

146 points by therabbithole posted 1 day ago • 130 comments

EmacsConf 2024 (emacsconf.org)

144 points by hprotagonist posted 2 days ago • 9 comments

A pro-science, pro-progress, techno-optimistic health textbook from 1929 (moreisdifferent.blog)

137 points by drcwpl posted 1 day ago • 161 comments

Show HN: A 5th order motion planner with PH spline blending, written in Ada (600f3559.prunt-docs.pages.dev)

114 points by LiamPowell posted 2 days ago • 32 comments

Contribution of childhood lead exposure to psychopathology in the US (acamh.onlinelibrary.wiley.com)

112 points by ndsipa_pomu posted 1 day ago • 105 comments

Oracle files notice of appearance for JavaScript trademark [pdf] (deno.com)

104 points by cfnewsperson1 posted 1 day ago • 82 comments

Show HN: Open-Source Colab Notebooks to Implement Advanced RAG Techniques (github.com)

98 points by hbamoria posted 2 days ago • 26 comments

History of rat control in Alberta (alberta.ca)

95 points by matteoraso posted 2 days ago • 92 comments

Self-Funding Harberger Taxes (gwern.net)

93 points by surprisetalk posted 1 day ago • 91 comments

Deploying Containers on NixOS: A Guide (bkiran.com)

84 points by bkiran posted 1 day ago • 57 comments

Why did clothing become boring? (resobscura.substack.com)

84 points by benbreen posted 1 day ago • 120 comments

Test Driven Development (TDD) for your LLMs? Yes please, more of that please (blog.helix.ml)

83 points by lewq posted 1 day ago • 29 comments

The Hoare Cube (johnwickerson.wordpress.com)

81 points by matt_d posted 1 day ago • 18 comments

Show HN: Vekos – a Rust OS with Built-In Cryptographic Verification (github.com)

81 points by jgiraldo29 posted 1 day ago • 15 comments

Awk in 20 Minutes (2015) (ferd.ca)

81 points by ayoisaiah posted 1 day ago • 20 comments

Interview with Dr. Ken Iverson (1982) (arraycast.com)

76 points by tosh posted 1 day ago • 20 comments

The ambiguous witness of Dietrich Bonhoeffer (2014) (newcriterion.com)

71 points by Pamar posted 1 day ago • 41 comments

How Typing Transformed Nietzsche's Consciousness (thereader.mitpress.mit.edu)

69 points by bookofjoe posted 1 day ago • 38 comments

Launch HN: Parsagon (YC W21) – AI for public affairs and government relations

68 points by sand1929 posted 1 day ago • 53 comments

Splash pads are fountains of fecal material; CDC reports 10K illnesses (arstechnica.com)

63 points by bookofjoe posted 1 day ago • 52 comments

You're Breathtaking [Godot #100000] (github.com)

63 points by Philpax posted 1 day ago • 4 comments

The "Bird and Baby" grows up: inside the new Eagle and Child (oxfordclarion.uk)

62 points by Doctor_Fegg posted 1 day ago • 26 comments

Apple Releases iCloud Passwords Add-On for Firefox (macrumors.com)

57 points by frizlab posted 1 day ago • 14 comments

OpenRCT2 – RollerCoaster Tycoon 2 in browser using emscripten (github.com)

57 points by goodburb posted 1 day ago • 10 comments

Russia's Dead Drop Drug Revolution (globalinitiative.net)

57 points by nkko posted 1 day ago • 32 comments

The Tragedy of Stafford Beer (2023) (kevinmunger.substack.com)

57 points by anigbrowl posted 2 days ago • 35 comments

UnitedHealthcare CEO Brian Thompson Fatally Shot in Manhattan (bloomberg.com)

56 points by mupuff1234 posted 1 day ago • 15 comments

Automated reasoning to remove LLM hallucinations (aws.amazon.com)

56 points by rustastra posted 2 days ago • 38 comments

Glyphosate exacerbates neuroinflammation and Alzheimer's disease-like pathology (jneuroinflammation.biomedcentral.com)

50 points by gnabgib posted 1 day ago • 20 comments

On Bullshit (2005) (press.princeton.edu)

48 points by kaladin-jasnah posted 2 days ago • 8 comments

AI Stole the Joy of Programming (paulefou.com)

47 points by svalee posted 1 day ago • 71 comments

Voyagers Ready to Go Dark (nautil.us)

44 points by jethronethro posted 2 days ago • 3 comments

Drawbacks and solutions for the Meilisearch document indexer (blog.kerollmops.com)

44 points by ko_pivot posted 2 days ago • 8 comments

Lead exposure in last century shrank IQ scores of half of Americans (today.duke.edu)

43 points by geox posted 1 day ago • 9 comments

Keyset cursors, not offsets, for Postgres pagination (blog.sequinstream.com)

42 points by todsacerdoti posted 1 day ago • 4 comments

S3 Tables (meltware.com)

41 points by pongogogo posted 1 day ago • 2 comments

Pocket 4 with 8.8″ High-Refresh LTPS Screen, 64GB RAM, 2TB SSD, and 45Wh Battery (linuxgizmos.com)

39 points by teleforce posted 2 days ago • 16 comments

Native Swift on Android, Part 2: Your First Swift Android App (skip.tools)

37 points by serial_dev posted 1 day ago • 3 comments

Certificate Authorities and the Fragility of Internet Safety (azeemba.com)

36 points by LinuxBender posted 1 day ago • 30 comments

Show HN: LimeJourney – open-source Customer Engagement Platform (limejourney.com)

36 points by flyingsky posted 1 day ago • 20 comments

Show HN: A Directory of Free, Open Source Alternatives to Popular Software (alternateoss.com)

35 points by syakirurahman posted 1 day ago • 12 comments

Stop Requiring CRLF Line Endings (fossil-scm.org)

33 points by smartmic posted 1 day ago • 36 comments

Linux TCP So_reuseport: Usage and Implementation (linuxjournal.rubdos.be)

33 points by todsacerdoti posted 1 day ago • 9 comments

DSQL Vignette: Reads and Compute (brooker.co.za)

31 points by louis-paul posted 1 day ago • 5 comments

Debian Stable and the Framework 16 (dataplane.org)

31 points by jtkristoff posted 1 day ago • 18 comments

Amazon and Google Must Keep Their Promises on Project Nimbus (eff.org)

31 points by hn_acker posted 2 days ago

Insurance Claim Denials: Worst Companies and How to Appeal (valuepenguin.com)

30 points by carabiner posted 1 day ago • 4 comments

Veo and Imagen 3: Announcing new video and image generation models on Vertex AI (cloud.google.com)

30 points by srameshc posted 1 day ago • 15 comments

Can we make a camera see behind walls? [video] (youtube.com)

29 points by ACAVJW4H posted 1 day ago • 14 comments

Show HN: Amurex – A cursor like copilot for meetings but also open source (github.com)

27 points by arsenkk posted 1 day ago • 23 comments

93-year-old YouTuber back in business after being kicked off platform (cbc.ca)

27 points by fbelzile posted 1 day ago • 50 comments

Telegram U-turns and joins child safety scheme (bbc.com)

26 points by tartoran posted 1 day ago • 36 comments

Fish Speech 1.5 (github.com)

24 points by artninja1988 posted 1 day ago • 1 comments

Anduril Partners with OpenAI to Advance US AI Leadership and Protect US Forces (anduril.com)

24 points by sandwichsphinx posted 1 day ago • 4 comments

Pinecone integrates AI inferencing with vector database (blocksandfiles.com)

24 points by jimminyx posted 1 day ago • 18 comments

Bringing the Instructions to the Data (mattpo.pe)

24 points by mattpope posted 2 days ago • 3 comments

Crunchy Data Warehouse: Postgres with Iceberg for High Performance Analytics (crunchydata.com)

23 points by petercooper posted 1 day ago • 2 comments

FBI Warns iPhone and Android Users–Stop Sending Texts (forbes.com)

23 points by _____k posted 2 days ago • 1 comments

Square Zero: hide silly messages in decorative borders (danwilkerson.com)

22 points by danwilkerson posted 1 day ago • 3 comments

Russia uses civilians as 'target practice' for killer drones (ft.com)

22 points by quick_brown_fox posted 1 day ago • 22 comments

Avatar robot cafe in Tokyo provides independence for bedridden 'pilots' (mainichi.jp)

22 points by bookofjoe posted 2 days ago • 1 comments

UnitedHealthcare executive killed in Manhattan in targeted attack (reuters.com)

21 points by JumpCrisscross posted 1 day ago • 9 comments

GenCast Predicts Weather with Accuracy (deepmind.google)

20 points by xnx posted 1 day ago • 1 comments

Pisces: UK regulated market for private shares [pdf] (assets.publishing.service.gov.uk)

20 points by thom posted 1 day ago • 12 comments

The Army built a giant concrete pyramid in North Dakota and used it for 6 months (taskandpurpose.com)

20 points by PaulHoule posted 2 days ago • 6 comments

It's not enough to be right as an engineer (databased.pedramnavid.com)

18 points by randyzwitch posted 1 day ago • 1 comments

CEO of UnitedHealthcare Is Fatally Shot in Midtown Manhattan (nytimes.com)

18 points by Mainsail posted 1 day ago • 2 comments

FBI tells telecom firms to boost security following Chinese hacking campaign (apnews.com)

17 points by voisin posted 1 day ago • 9 comments

Introducing Qodo Cover: Automate Test Coverage (qodo.ai)

16 points by timbilt posted 1 day ago • 8 comments

HowStuffWorks founder Marshall Brain sent final email before sudden death (arstechnica.com)

15 points by LinuxBender posted 1 day ago • 3 comments

Splash pads are fountains of fecal material (arstechnica.com)

15 points by LinuxBender posted 2 days ago • 1 comments

Ancient texts reveal how Mesopotamians experienced emotions in their bodies (phys.org)

14 points by arto posted 1 day ago

LegalEagle: I'm Begging You, Stop Hiring AI Lawyers [video] (youtube.com)

14 points by Topfi posted 1 day ago • 4 comments

Misperception of the facial appearance that the opposite-sex desires (journals.plos.org)

14 points by cainxinth posted 1 day ago • 6 comments

Amazon Sued for 'Fake Discounts' (blog.cheapism.com)

14 points by galaxyLogic posted 2 days ago • 2 comments

Andy Grove Was Right (daringfireball.net)

14 points by robenkleene posted 2 days ago • 3 comments

Millions of people in Cuba without power after grid collapse (reuters.com)

13 points by throwup238 posted 1 day ago

CEO of UnitedHealthcare Is Fatally Shot in Midtown Manhattan (nytimes.com)

13 points by ctoth posted 1 day ago • 6 comments

UnitedHealth's CEO Shot Dead (wsj.com)

13 points by jkuria posted 1 day ago • 5 comments

What to Do About Conspiracy Theories? (taylorfrancis.com)

13 points by tokai posted 1 day ago • 6 comments

Godot Isn't Making It (wheresyoured.at)

13 points by rcarmo posted 1 day ago • 14 comments

How to Tell Great Stories (julian.com)

13 points by t55 posted 2 days ago

Hyundai Has Best Month Ever in U.S. Electric SUV Sales Suddenly Double (electrek.co)

12 points by m463 posted 1 day ago • 13 comments

French PM, Macron Ousted After National Assembly Approves No-Confidence Vote (wsj.com)

12 points by Jimmc414 posted 1 day ago • 1 comments

The EU proposal to scan all your WhatsApp chats is back on the agenda. TechRadar (techradar.com)

12 points by janandonly posted 1 day ago

Return To Office mandates and brain drain (papers.ssrn.com)

12 points by ssivark posted 1 day ago • 2 comments

UnitedHealthcare CEO Brian Thompson fatally shot outside of Hilton hotel (nypost.com)

12 points by jrpelkonen posted 1 day ago

What Happened to Intel? (theverge.com)

12 points by tambourine_man posted 2 days ago • 3 comments

End of Hachette v. Internet Archive (blog.archive.org)

11 points by hn_acker posted 1 day ago

No apps, no swipes – every EV will get Supercharger-like charging in 2025 (electrek.co)

11 points by m463 posted 1 day ago • 6 comments

Anthem Blue Cross Won't Pay for the Complete Duration of Anesthesia for Surgery (asahq.org)

11 points by healsdata posted 1 day ago • 3 comments

DC accuses Amazon of excluding some residents from Prime benefits (wusa9.com)

11 points by ivewonyoung posted 1 day ago • 1 comments

CPUBenchmark.net says M3 is faster than all M4s on single thread performance (cpubenchmark.net)

11 points by joas_coder posted 1 day ago • 16 comments

65,000-Year-Old Neanderthal Hearth Structure Discovered in Gibraltar (sci.news)

11 points by isaacfrond posted 1 day ago

Rust9x update: Rust 1.84.0-beta (seri.tools)

11 points by todsacerdoti posted 2 days ago • 1 comments

PBS Retro (therokuchannel.roku.com)

10 points by bookofjoe posted 1 day ago • 1 comments

Amazon accused of cheating low-income Prime users out of two-day deliveries (theregister.com)

10 points by rntn posted 1 day ago

US recommends encrypted messaging as Chinese hackers linger in telecom networks (arstechnica.com)

10 points by eysquared posted 1 day ago • 1 comments

Curriculum Vitae of Donald E. Knuth [pdf] (www-cs-faculty.stanford.edu)

10 points by joebig posted 1 day ago • 1 comments

How to look out for yourself inside a particular company (2018) (rachelbythebay.com)

10 points by comebhack posted 1 day ago • 2 comments

Show HN: Belief.garden – a social network for civil discussion (belief.garden)

10 points by klntsky posted 2 days ago • 4 comments

Putin-controlled aircraft deported Ukrainian children, U.S. research alleges (reuters.com)

10 points by MilnerRoute posted 2 days ago • 1 comments

Why not 2 Timezones for US? (twitter.com)

10 points by kumarm posted 2 days ago • 5 comments

Lawsuit claims UnitedHealth AI wrongfully denies elderly extended care (reuters.com)

9 points by ummonk posted 1 day ago

We have been pirated; we're a real game studio now (itch.io)

9 points by stoatstudios posted 1 day ago

Google Introduces A.I. Agent That Aces 15-Day Weather Forecasts (nytimes.com)

9 points by ctc24 posted 1 day ago • 2 comments

Amazon secretly slowed deliveries, deceived anyone who complained, lawsuit says (arstechnica.com)

9 points by pseudolus posted 1 day ago • 6 comments

NSA Guidance Urges Visibility and Device Hardening Against PRC-Affiliated Threat (nsa.gov)

9 points by bookofjoe posted 1 day ago

Destroying an Innocent Person's Home to Arrest a Suspect (techdirt.com)

9 points by hn_acker posted 1 day ago • 1 comments

The bad news: the US is 100% reliant on imported gallium, primarily from China (twitter.com)

9 points by dtquad posted 1 day ago • 1 comments

The UK's network of free hiking 'hotels' (bbc.com)

9 points by ranit posted 1 day ago

"Nightmare" Zipcar outage is a warning against complete app dependency (arstechnica.com)

9 points by ndsipa_pomu posted 1 day ago • 2 comments

UK Police and Fact Continue IPTV Piracy Whack-a-Mole (torrentfreak.com)

9 points by hn_acker posted 2 days ago

China's single-child generation frets over country's pension system (channelnewsasia.com)

9 points by sohkamyung posted 2 days ago

Plug Power Failure Part I: Critical DOE Loan at Risk Due to False Water Data (hntrbrk.com)

8 points by impish9208 posted 1 day ago • 2 comments

Russia uses civilians as 'target practice' for killer drones (ft.com)

8 points by metabagel posted 1 day ago • 2 comments

Tell HN: China has all your SMS 2FA

8 points by 0xbadcafebee posted 1 day ago

PyMyFlySpy: Track your flight using its headrest data (robertheaton.com)

8 points by khalby786 posted 1 day ago • 1 comments

Brief Introduction to OCI Containers on FreeBSD (people.freebsd.org)

8 points by vermaden posted 1 day ago • 1 comments

Show HN: Eyed Out – Privacy-Focused Browser (apps.apple.com)

8 points by cesp99 posted 1 day ago • 2 comments

Drinking Habit Is More Dangerous Than Bingeing (nytimes.com)

8 points by wslh posted 1 day ago • 8 comments

The Thompson Twins Adventure (C64 game on flexi disk vinyl) (en.wikipedia.org)

8 points by JojoFatsani posted 2 days ago • 2 comments

Producing circuit boards from leaves would prevent millions of tons of e-waste (science.org)

8 points by geox posted 2 days ago • 2 comments

Geoengineering Could Alter Global Climate. Should It? (undark.org)

8 points by EA-3167 posted 2 days ago

Microsoft: Tough Hardware Requirements for Windows 11 Are 'Non-Negotiable' (pcmag.com)

7 points by leotravis10 posted 1 day ago • 6 comments

Automatic DIY polarity-independent AA battery charger (hackaday.io)

7 points by kuba-orlik posted 1 day ago

FBI Warns Americans to Start Using Encrypted Messaging Apps (gizmodo.com)

7 points by rntn posted 1 day ago • 2 comments

UK police forces withdraw from X platform amid content concerns (reuters.com)

7 points by taimurkazmi posted 1 day ago • 4 comments

Human Interaction Is Now a Luxury Good (nytimes.com)

7 points by mooreds posted 1 day ago • 2 comments

Global investigation exposes alleged billion-dollar Russian laundering network (theguardian.com)

7 points by uxhacker posted 1 day ago

Uber introduces Shuttle buses in India (restofworld.org)

7 points by Brajeshwar posted 1 day ago

Qodo's autonomous agent tackles the complexities of regression testing (venturebeat.com)

7 points by daphnemichala posted 1 day ago

House panel concludes that Covid-19 pandemic came from a lab leak (science.org)

7 points by pseudolus posted 1 day ago

Musk Signals Fresh Push to End US Daylight Saving Time (twitter.com)

7 points by m463 posted 1 day ago • 1 comments

Apple accused of silencing workers, spying on personal devices (reuters.com)

7 points by rmason posted 2 days ago

Interceptor Carrier Board v2.0 Adds 4 GbE Ports for RPi CM4 and Banana Pi CM4 (linuxgizmos.com)

7 points by teleforce posted 2 days ago

A clean break: Scientists convert plastics into soaps and detergents (phys.org)

7 points by PaulHoule posted 2 days ago • 3 comments

What Are the Latest Scraping APIs or Services/Websites?

6 points by jdcampolargo posted 1 day ago • 7 comments

Binance accused of tax evasion by India's finance department (theregister.com)

6 points by LinuxBender posted 1 day ago

Probabilistic weather forecasting with machine learning (nature.com)

6 points by vinni2 posted 1 day ago • 1 comments

Open source router firmware project OpenWrt ships its own repairable hardware (theregister.com)

6 points by LinuxBender posted 1 day ago • 2 comments

Show HN: Guard – LLM agent that scans your AWS account for misconfigs (guard.dev)

6 points by shehbaj posted 1 day ago

CheerpX 1.0: High performance x86 virtualization in the browser via WebAssembly (labs.leaningtech.com)

6 points by apignotti posted 1 day ago

CEO of UnitedHealthcare Fatally Shot in New York City (bbc.co.uk)

6 points by blenderob posted 1 day ago • 2 comments

Health officials investigate mystery disease in southwest Congo after 143 deaths (apnews.com)

6 points by etiam posted 1 day ago

U.S. Offered $10M for Hacker Just Arrested by Russia (krebsonsecurity.com)

6 points by todsacerdoti posted 1 day ago • 1 comments

Stanford misinformation expert admits to ChatGPT 'hallucinations' in court (stanforddaily.com)

6 points by Tomte posted 1 day ago

The State of U.S. Science and Engineering 2024 (ncses.nsf.gov)

6 points by noch posted 2 days ago

5-plus feet of snow and counting: More snow is coming to the Great Lakes (cnn.com)

6 points by LinuxBender posted 2 days ago • 1 comments

Russian criminals helped UK drug gangs launder lockdown cash (bbc.co.uk)

5 points by frereubu posted 1 day ago

Elon Musk's more than $50B pay deal at Tesla was rejected again (npr.org)

5 points by makerdiety posted 1 day ago

Forever chemicals found in bottled and tap water from around the world (phys.org)

5 points by akyuu posted 1 day ago • 1 comments

YAML Schemas in Emacs with Eglot – just renewed blog too (jointhefreeworld.org)

5 points by jjba23 posted 1 day ago

Sam Altman lowers the bar for AGI (theverge.com)

5 points by rntn posted 1 day ago • 3 comments

Trump nominates Jared Isaacman to become the next NASA administrator (arstechnica.com)

5 points by pseudolus posted 1 day ago

Valve's Flickering Lights (alanzucconi.com)

5 points by PaulHoule posted 1 day ago • 1 comments

Trump selects Isaacman to be NASA administrator (spacenews.com)

5 points by makira posted 1 day ago

Google's DeepMind tackles weather forecasting, with great performance (arstechnica.com)

5 points by Gedxx posted 1 day ago

I was wrong about GraphQL (wundergraph.com)

5 points by thunderbong posted 1 day ago

Systems Thinking Wisdoms (thelsweekly.substack.com)

5 points by sherilm posted 1 day ago

Cycling is ten times more important than electric cars net-zero cities (theconversation.com)

5 points by doener posted 1 day ago • 1 comments

MetaBrainz Foundation – music, art, and book metadata (metabrainz.org)

5 points by andrei-akopian posted 1 day ago

Save Standard Time (savestandardtime.com)

5 points by baxtr posted 1 day ago • 3 comments

I developed Dynamic QR code generator with analytics (989tools.com)

5 points by nookeshkarri7 posted 1 day ago • 4 comments

China calls on universities to provide 'love education' to boost birth rates (reuters.com)

5 points by alephnerd posted 1 day ago • 3 comments

China banned exports of rare minerals to the US (bloomberg.com)

5 points by biscuit1v9 posted 1 day ago • 1 comments

US House Select Subcommittee 2-Year Review of Covid-19 Pandemic: Lessons Learned (oversight.house.gov)

5 points by walterbell posted 2 days ago

Scalable Server SQLite Apps (servicestack.net)

5 points by mythz posted 2 days ago

Trump picks Musk ally Jared Isaacman to head NASA (reuters.com)

4 points by caiobegotti posted 1 day ago • 3 comments

It's Taking Longer to Find a New Job in the US (bloomberg.com)

4 points by toomuchtodo posted 1 day ago • 1 comments

Trump Picks Jared Isaacman, an Entrepreneur and Private Astronaut, to Lead NASA (nytimes.com)

4 points by xnx posted 1 day ago

Cancer Risk Declines in Old Age, New Research Helps Explain Why (mskcc.org)

4 points by geox posted 1 day ago

The Planning Machine (2014) (newyorker.com)

4 points by rbanffy posted 1 day ago • 1 comments

Want to Live Longer? You Better Start Moving–All Day Long (outsideonline.com)

4 points by thehoff posted 1 day ago

Is this the biggest industrial espionage campaign in history? (freethink.com)

4 points by neofrommatrix posted 1 day ago

Chrome doubled its Speedometer scores on Android (blog.chromium.org)

4 points by feross posted 1 day ago

Belgian sex workers get unemployment, maternity leave, and health insurance (abc.net.au)

4 points by speckx posted 1 day ago

China bans exports to US of gallium, germanium, antimony (apnews.com)

4 points by UkiahSmith posted 1 day ago

The Booze of Monkey Island is an unofficial fan game (bean-adventure-agency.itch.io)

4 points by doener posted 1 day ago

Lip-Bu Tan left Intel board after differences over chipmaker's revival plan (reuters.com)

4 points by walterbell posted 2 days ago

Mistakes that will kill your SSD early (pcworld.com)

3 points by amichail posted 1 day ago

London Perl Workshop (youtube.com)

3 points by creer posted 1 day ago

Brian Thompson, the UnitedHealthcare CEO, Gunned Down in New York (npr.org)

3 points by kerkeslager posted 1 day ago • 3 comments

MilkyTracker v1.05 – Major Release (milkytracker.org)

3 points by subbz posted 1 day ago

Tim Cook Wants Apple to Save Your Life (wired.com)

3 points by tambourine_man posted 1 day ago • 1 comments

PSA: Your Twitter/X account is about to change forever (mashable.com)

3 points by MilnerRoute posted 1 day ago • 2 comments

Google DeepMind team develops AI weather model (technologyreview.com)

3 points by rrrrrrrrrrrryan posted 1 day ago

"Nightmare" Zipcar outage is a warning against complete app dependency (arstechnica.com)

3 points by nobody9999 posted 1 day ago • 1 comments

Apple's Activation Lock is becoming a barrier to recycling (youtube.com)

3 points by trinsic2 posted 1 day ago • 1 comments

Functional Core, Imperative Shell – Scott Wlaschin (youtube.com)

3 points by fuzztester posted 1 day ago • 1 comments

Yet Another List of Random Opinions on Writing Readable Code and Other Rants (lucavall.in)

3 points by ingve posted 1 day ago

Precomputation (jamesg.blog)

3 points by zerojames posted 1 day ago • 1 comments

Show HN: Paul Graham Essays but Better UX (paulgraham.blog)

3 points by naix posted 1 day ago • 2 comments

Andy Grove: Rich, Famous, Smart and Wrong (2007) (science.org)

3 points by hprotagonist posted 2 days ago • 1 comments

Ashby (YC W19) Is Hiring Principal Platform Engineers (ashbyhq.com)

1 points by abhikp posted 1 day ago

Reprompt (YC W24) Is Hiring an Engineer to Build Location Agents

1 points by rob313 posted 1 day ago

Dependency management fatigue, or why I ditched React for Go+HTMX+Templ (blog.erodriguez.de)

269 points by todsacerdoti posted 2 days ago • 288 comments

Show HN: My C compiler compiled itself (github.com)

268 points by keyvank posted 2 days ago • 125 comments

8 months of OCaml after 8 years of Haskell in production (2023) (chshersh.com)

264 points by droideqa posted 3 days ago • 276 comments

The story of Rogue (spillhistorie.no)

263 points by gaws posted 2 days ago • 101 comments

Twice-Yearly HIV Shot Shows 100% Effectiveness in Women (apnews.com)

249 points by bear_with_me posted 3 days ago • 142 comments

Blizzard's pulling of Warcraft I and II tests GOG's new Preservation Program (arstechnica.com)

238 points by Tomte posted 3 days ago • 182 comments

The Tube Computer (thetubecomputer.com)

230 points by elvis70 posted 2 days ago • 63 comments

Raspberry Pi boosts Pi 5 performance with SDRAM tuning (jeffgeerling.com)

225 points by nfriedly posted 3 days ago • 143 comments

No need to email me about Cisco AnyConnect (daniel.haxx.se)

218 points by TangerineDream posted 2 days ago • 68 comments

Distributed Erlang (vereis.com)

208 points by todsacerdoti posted 3 days ago • 61 comments

Tweaking Stunt Island's 30-year-old 3D engine (annali.netlify.app)

204 points by alberto-m posted 2 days ago • 46 comments

Company claims 1k% price hike drove it from VMware to open source rival (arstechnica.com)

203 points by elorant posted 2 days ago • 195 comments

FTC takes action against Gravy Analytics, Venntel for selling location data (ftc.gov)

191 points by gnabgib posted 2 days ago • 155 comments

Amazon Aurora DSQL (aws.amazon.com)

184 points by aws_hero posted 2 days ago • 133 comments

Phishers Love New TLDs Like .shop, .top and .xyz (krebsonsecurity.com)

169 points by todsacerdoti posted 2 days ago • 209 comments

We switched from Next.js to Astro (and why it might interest you) (datocms.com)

162 points by steffoz posted 2 days ago • 156 comments

Show HN: Copper – Open-source robotics in Rust with deterministic log replay (github.com)

160 points by gbin posted 3 days ago • 35 comments

Broadcom loses another big VMware customer (theregister.com)

147 points by belter posted 2 days ago • 110 comments

Kagi Search API (help.kagi.com)

144 points by edweis posted 2 days ago • 143 comments

Stephen King to shut down his 3 radio stations in Maine (nytimes.com)

135 points by tintinnabula posted 2 days ago • 216 comments

The Porsche Macan EV is being recalled because its headlights are too bright (insideevs.com)

132 points by josephcsible posted 2 days ago • 282 comments

Intel Launches Arc B-Series Graphics Cards (intel.com)

129 points by 9front posted 2 days ago • 4 comments

Text Editing Hates You Too (2019) (lord.io)

125 points by airstrike posted 2 days ago • 59 comments

My brand new digitizing workflow using a 25 year old film scanner (blog.vladovince.com)

123 points by williamsmj posted 2 days ago • 60 comments

Show HN: Book and change flights with one email (bonbook.co)

122 points by themagyar posted 3 days ago • 83 comments

California teacher dies from suspected rabid bat bite (ktla.com)

118 points by LinuxBender posted 2 days ago • 186 comments

‘With brain preservation, nobody has to die’ (theguardian.com)

116 points by bookofjoe posted 2 days ago • 447 comments

A new home for Python-build-standalone (astral.sh)

115 points by burntsushi posted 2 days ago • 34 comments

South Korea President Yoon declares martial law (reuters.com)

111 points by IdealeZahlen posted 2 days ago • 31 comments

AI poetry is indistinguishable from human poetry and is rated more favorably (nature.com)

110 points by lr0 posted 2 days ago • 203 comments

MTA's A.I. bus cameras issue mistaken parking violations (nbcnewyork.com)

87 points by croes posted 2 days ago • 112 comments

My domain registrar (DNSimple) tried to 5x the cost of my reseller plan (watilo.com)

85 points by corywatilo posted 2 days ago • 54 comments

.NET Support on Heroku (blog.heroku.com)

85 points by runesoerensen posted 3 days ago • 55 comments

Two decades after Enron's bankruptcy, the company is back as a crypto firm? (arstechnica.com)

84 points by pseudolus posted 2 days ago • 66 comments

Guile-Emacs Relaunched (emacsconf.org)

83 points by Kholin posted 3 days ago • 36 comments

Tip pressure might work in the moment, but customers are less likely to return (theconversation.com)

83 points by gnabgib posted 3 days ago • 181 comments

Creating a Proxmox or QEMU ChromeOS Flex VM (kevindavid.org)

78 points by goodburb posted 2 days ago • 20 comments

Ask HN: Why did no one save the Living Computers museum in Seattle?

71 points by superconduct123 posted 2 days ago • 78 comments

Launch HN: Vocera (YC F24) – Testing and Observability for Voice AI

71 points by Sid45 posted 2 days ago • 33 comments

On-scalp printing of personalized electroencephalography e-tattoos (cell.com)

64 points by bookofjoe posted 2 days ago • 7 comments

Show HN: High School Student's First App – NWS Weather Report (weatherreportnow.com)

62 points by Orcazephyr posted 3 days ago • 28 comments

Show HN: I built an AI tool to analyze SEC filings the minute they're released (docdelta.ca)

61 points by docdeltaneer posted 2 days ago • 56 comments

Data-engineer-handbook: everything to learn about data engineering (kifinity.com)

58 points by codezerox posted 2 days ago • 1 comments

FTC Bans Location Data Company That Powers the Surveillance Ecosystem (404media.co)

55 points by marban posted 2 days ago • 16 comments

Rust library for building no-boilerplate CLI apps (github.com)

53 points by PaulHoule posted 2 days ago • 13 comments

Certain names make ChatGPT grind to a halt, and we know why (arstechnica.com)

48 points by rbanffy posted 2 days ago • 17 comments

Amazon Announces Supercomputer, New Server Powered by Homegrown AI Chips (wsj.com)

44 points by wallflower posted 2 days ago • 16 comments

Universities enrolling foreign students with poor English, BBC finds (bbc.com)

39 points by impish9208 posted 2 days ago • 93 comments

US officials urge Americans to use encrypted apps amid unprecedented cyberattack (nbcnews.com)

37 points by leotravis10 posted 2 days ago • 13 comments

South Korea declares martial law (koreaherald.com)

37 points by RyeCombinator posted 2 days ago • 18 comments

What Is Software Anyways? Where Does It Exist? (jimmyhmiller.github.io)

37 points by tobr posted 3 days ago • 52 comments

Walmart buys vizio to use its TVs as a new way to blast you with ads (gizmodo.com)

34 points by rntn posted 2 days ago • 31 comments

1Password joins the Rails Foundation: Strengthening the community, developers (blog.1password.com)

34 points by ksec posted 2 days ago • 7 comments

Thoughts on DuckDB's Grammar Patching Thing (buttondown.com)

34 points by foldU posted 2 days ago • 3 comments

Slop (en.wikipedia.org)

34 points by 65 posted 3 days ago • 15 comments

New era of slop security reports for open source (sethmlarson.dev)

31 points by detaro posted 2 days ago • 13 comments

Derivative at a Discontinuity (alok.github.io)

29 points by yuppiemephisto posted 2 days ago • 19 comments

Compilation on the GPU? A Feasibility Study (dl.acm.org)

27 points by luu posted 2 days ago • 12 comments

Addictive nut is driving record rates of cancer (telegraph.co.uk)

26 points by svenfaw posted 3 days ago • 12 comments

Are grownups just giant kids? (newyorker.com)

25 points by marban posted 2 days ago • 74 comments

Sqlc: Data access simplified. Throw away your ORM (docs.sqlc.dev)

23 points by kaashmonee posted 2 days ago • 20 comments

China bans export of key minerals to U.S. as trade frictions escalate (reuters.com)

23 points by razerbeans posted 2 days ago • 1 comments

European Federation of Journalists to stop posting content on X (thelondoneconomic.com)

23 points by healsdata posted 3 days ago • 8 comments

MPTA Finds Evidence of Gravitational Wave Background (spaceaustralia.com)

23 points by raattgift posted 3 days ago

Black plastics may contain toxic compounds that can leach into food, experts say (cbc.ca)

21 points by pseudolus posted 2 days ago • 4 comments

Data brokers may be banned from selling your social security number (theverge.com)

21 points by hampus posted 2 days ago • 4 comments

China bans exports to US of gallium, germanium in response to chip sanctions (apnews.com)

20 points by tsujamin posted 2 days ago • 11 comments

Webhooks Are Harder Than They Seem (svix.com)

19 points by KenRuf posted 2 days ago • 3 comments

Australia Struggling with Oversupply of Solar Power (abc.net.au)

18 points by m463 posted 2 days ago • 28 comments

New Amazon S3 Tables: Storage optimized for analytics workloads (aws.amazon.com)

18 points by craigkerstiens posted 2 days ago • 3 comments

China Bans Rare Mineral Exports to the U.S. (nytimes.com)

18 points by thelastgallon posted 2 days ago • 1 comments

Police investigate damage to internet cable between Finland and Sweden (yle.fi)

18 points by Hamuko posted 2 days ago • 5 comments

A Personally Significant Bluesky Moment (whatever.scalzi.com)

18 points by akuchling posted 3 days ago • 4 comments

FreeBSD 14.2-Release Now Available (lists.freebsd.org)

18 points by cperciva posted 3 days ago • 3 comments

Supply Chain Attack Detected in Solana/Web3.js Library (socket.dev)

17 points by feross posted 2 days ago

OpenAI reveals why ChatGPT won't say "David Mayer" (neowin.net)

17 points by bundie posted 2 days ago • 7 comments

Documents contradict Google's claims about its Project Nimbus contract (theintercept.com)

17 points by cannibalXxx posted 3 days ago

Tesla Cybertruck workers begin 3-day furlough, signaling demand slowdown (finance.yahoo.com)

16 points by addaon posted 2 days ago • 25 comments

DSQL Vignette: Aurora DSQL, and a Personal Story (brooker.co.za)

16 points by daigoba66 posted 2 days ago

AI Advent of Code: Implementing Papers (leetarxiv.com)

16 points by muragekibicho posted 2 days ago • 2 comments

The Verge now has a subscription (theverge.com)

15 points by hadrien01 posted 2 days ago • 3 comments

Network Basics for Hackers: How Networks Work and How They Break (archive.org)

15 points by teleforce posted 2 days ago

Italy bans Airbnb self-check-ins (cnn.com)

14 points by mgiannopoulos posted 2 days ago • 4 comments

Chicago's State Capacity Crisis (citythatworks.substack.com)

14 points by paulpauper posted 2 days ago • 2 comments

Internal Google documents reveal concerns about its cloud contract with Israel (theverge.com)

14 points by Tomte posted 2 days ago • 4 comments

Apple Sued for 'All-Seeing Eye' Employee Device Monitoring Policy (macrumors.com)

14 points by quyleanh posted 3 days ago • 1 comments

Meta's Mark Zuckerberg seeks 'active role' in Donald Trump's tech policies (ft.com)

13 points by elsewhen posted 2 days ago • 2 comments

Vietnamese tycoon loses death row appeal over biggest bank fraud (bbc.co.uk)

13 points by mellosouls posted 2 days ago • 5 comments

Korea arrests CEO for adding DDoS feature to satellite receivers (bleepingcomputer.com)

13 points by sandwichsphinx posted 3 days ago

Social drinkers on obesity drugs lose the taste for alcohol (npr.org)

13 points by pseudolus posted 3 days ago • 13 comments

Against 'Free Market Authoritarianism' (isonomiaquarterly.com)

12 points by brandonlc posted 2 days ago • 6 comments

NCSI Probing Needs to Die (github.com)

12 points by stryngs42 posted 3 days ago • 7 comments

Ask HN: New Resources for Learning Complexity Theory

12 points by wannabebarista posted 3 days ago • 1 comments

A Bird Flu Pandemic Would Be One of the Most Foreseeable Catastrophes in History (nytimes.com)

12 points by bookofjoe posted 3 days ago • 4 comments

Elon Musk's multibillion-dollar Tesla pay package blocked by a judge again (cnn.com)

12 points by breadwinner posted 3 days ago • 4 comments

A KeyLogger using eBPF written in Rust (github.com)

11 points by pythops posted 2 days ago

Chinese hack of global telecom providers is 'ongoing,' officials warn (politico.com)

11 points by c420 posted 2 days ago • 1 comments

Kolmogorov Complexity, and the Role of Inductive Biases in Machine Learning (arxiv.org)

11 points by rntn posted 2 days ago • 1 comments

P-99: Ninety-Nine Prolog Problems (ic.unicamp.br)

11 points by t55 posted 2 days ago

Tell HN: Why Fastmail is the best email service

11 points by stereoradonc posted 3 days ago • 2 comments

Is Technology Destroying Marriage? (piratewires.com)

10 points by xwall posted 2 days ago • 3 comments

Godot Isn't Making It (wheresyoured.at)

10 points by elorant posted 2 days ago • 9 comments

Sober curiosity: Why Gen Zers are reducing their alcohol consumption (medicalxpress.com)

10 points by PaulHoule posted 2 days ago

Christopher Hitchens and the Necessity of Universalism (salmagundi.skidmore.edu)

10 points by everybodyknows posted 2 days ago

Lockheed Martin challenges narrative on GPS vulnerability – SpaceNews (spacenews.com)

10 points by rbanffy posted 2 days ago • 7 comments

Man has 'finely tuned' plan to find £500M Bitcoin thrown in tip, court told (theguardian.com)

10 points by robaato posted 2 days ago

Ask HN: How to Market Before Building?

10 points by izwasm posted 2 days ago • 12 comments

California can't use all its solar power. That's a problem (sfgate.com)

10 points by doener posted 2 days ago • 2 comments

First ice-free day in the Arctic Ocean could come before 2030 (gu.se)

9 points by geox posted 2 days ago • 3 comments

Sound of traffic increases stress and anxiety, study finds (sciencedaily.com)

9 points by chippy posted 2 days ago • 1 comments

Modern Work Fucking Sucks (joanwestenberg.com)

9 points by ThatGeoGuy posted 2 days ago • 2 comments

China Hits Back at U.S. Chip Controls with Limits on Key Raw Materials (wsj.com)

9 points by sandwichsphinx posted 2 days ago • 1 comments

US chips are 'no longer safe' to buy, Chinese industry bodies say (reuters.com)

9 points by _____k posted 2 days ago

Biden administration bars China from buying HBM chips critical for AI (theregister.com)

9 points by sandwichsphinx posted 3 days ago • 1 comments

India takes out giant nationwide subscription to 13,000 journals (science.org)

9 points by jmsflknr posted 3 days ago • 1 comments

Why Did Intel Fire CEO Pat Gelsinger? (semiaccurate.com)

8 points by RachelF posted 2 days ago

The sham legacy of Richard Feynman [video] (youtube.com)

8 points by nabla9 posted 2 days ago • 4 comments

Delaware judge rejects Musk's $56B Tesla pay – again (reuters.com)

8 points by JumpCrisscross posted 2 days ago • 4 comments

The name 'David Mayer' crashes ChatGPT. Digital privacy requests may be at fault (techcrunch.com)

8 points by pseudolus posted 3 days ago • 1 comments

Mark Zuckerberg seeks 'active role' in Trump tech policy (theguardian.com)

7 points by rntn posted 2 days ago • 1 comments

FBI Seizure of Mastodon Server Data Is a Wakeup Call (2023) (eff.org)

7 points by busymom0 posted 2 days ago

Smartphones should carry health warning, Spanish government told (theguardian.com)

7 points by wslh posted 2 days ago

Three years after opening, X Denver residents say the party is over (denverpost.com)

7 points by ctoth posted 2 days ago

Martial law declared in South Korea (boingboing.net)

7 points by DemocracyFTW2 posted 2 days ago

South Korean Lawmakers Vote to Defy President, Demanding an End to Martial Law (nytimes.com)

7 points by miles posted 2 days ago

America Stopped Cooking with Tallow for a Reason (theatlantic.com)

7 points by paulpauper posted 2 days ago • 1 comments

Ask HN: How much would you pay for local LLMs?

7 points by nancy_le posted 2 days ago • 11 comments

Pakistan's Reliance on Chinese-Built Power Plants Is Strangling Its Economy (wsj.com)

7 points by JumpCrisscross posted 2 days ago • 1 comments

Jaguar Introduces Type 00 (jaguar.com)

7 points by jiwidi posted 2 days ago • 2 comments

Landlords Are Using AI to Raise Rents – and Cities Are Starting to Push Back (themarkup.org)

7 points by devonnull posted 3 days ago • 5 comments

Why America's economy is soaring ahead of its rivals (ft.com)

6 points by bookofjoe posted 2 days ago • 3 comments

Beauty of the Gentzen System (wyounas.github.io)

6 points by simplegeek posted 2 days ago

My Smartphone Was Ruining My Life. So I Quit (thefp.com)

6 points by fortran77 posted 2 days ago

Universal Construction – Category Theory and Why We Care [video] (youtube.com)

6 points by marvinborner posted 2 days ago

The casual moviegoer is a thing of the past. That's a problem for Hollywood (latimes.com)

6 points by thunderbong posted 2 days ago • 3 comments

NATO to boost efforts to counter Russian, Chinese sabotage acts (reuters.com)

6 points by testrun posted 2 days ago

Japan's Nomura bank boss takes 30% pay cut after worker tries to kill customer (theguardian.com)

6 points by pseudolus posted 2 days ago

2025 will be a bad year for remote work (computerworld.com)

6 points by dxs posted 3 days ago

Run a Simple Go Web Service on NixOS (mtlynch.io)

6 points by todsacerdoti posted 3 days ago • 2 comments

Committee on Oversight: After Action Review of the Covid-19 Pandemic (oversight.house.gov)

6 points by typeofhuman posted 3 days ago

Mastodon year in review feature upcoming (mastodon.social)

6 points by doener posted 3 days ago

Tape – the pocket audio sketchbook [video] (youtube.com)

5 points by ChrisArchitect posted 2 days ago • 1 comments

Apple says it uses Amazon's custom AI chips (cnbc.com)

5 points by ksec posted 2 days ago

Vodka maker Stoli files for bankruptcy in US after ransomware attack (bleepingcomputer.com)

5 points by gnabgib posted 2 days ago • 1 comments

U.S. officials say they still have not expelled Chinese telco hackers (washingtonpost.com)

5 points by howard941 posted 2 days ago

Elon Musk loses bid to reinstate Tesla pay plan, now worth $101B (arstechnica.com)

5 points by doener posted 2 days ago

How Gen Z Came to See Books as a Waste of Time (theatlantic.com)

5 points by marban posted 2 days ago • 2 comments

How to get better at remembering (psyche.co)

5 points by lr0 posted 2 days ago

Xerox, Nokia, BofA, Morgan Stanley's employees data dumped (theregister.com)

5 points by rbanffy posted 2 days ago

Ask HN: Working Capital Loan Integration

5 points by xvok posted 3 days ago • 2 comments

The BSD Daemon [video] (youtube.com)

4 points by rodrigo975 posted 2 days ago

Federal Employees Land Work from Home Deal Ahead of Trump (bloomberg.com)

4 points by toomuchtodo posted 2 days ago • 1 comments

Deus Ex Truth Bomb Compilation – All 3 Games (old.reddit.com)

4 points by debo_ posted 2 days ago • 1 comments

Ask HN: Product to improve monitoring and documentation: a good idea?

4 points by d--b posted 2 days ago • 5 comments

Cascading retrieval: Unifying dense and sparse vector embeddings with reranking (pinecone.io)

4 points by bobismyuncle posted 2 days ago

You Couldn't Replicate Our Study Because You're Ugly (cremieux.xyz)

4 points by delichon posted 2 days ago • 1 comments

I Was Wrong About Scrum, Again – By Adam Ard (rethinkingsoftware.substack.com)

4 points by rbanffy posted 2 days ago • 1 comments

The Youth Are 'Lifeless': Economist's Speech Goes Viral in China (bloomberg.com)

3 points by toomuchtodo posted 2 days ago • 1 comments

Cabo Verde's Potential for Innovation Through Drone Tech and Renewable Energy (santiago-martins.com)

3 points by petrusnonius posted 2 days ago

I was wrong about GraphQL (wundergraph.com)

3 points by wundegraphTeam posted 2 days ago

Introducing integrated inference: Embed, rerank, and retrieve data with one API (pinecone.io)

3 points by jimminyx posted 2 days ago

How a middle schooler found a new compound in a piece of goose poop (phys.org)

3 points by dxs posted 3 days ago

W3Schools Tryit Editor (w3schools.com)

3 points by Tcip posted 3 days ago • 1 comments

Openlayer (YC S21) is looking for top-tier design engineers (ycombinator.com)

1 points by vikasnair posted 2 days ago

Stack Auth (YC S24), open-source Auth0 alternative, is hiring Founding SWEs

1 points by n2d4 posted 2 days ago

Wasmer (YC S19) Is Hiring a SRE and DevOps Engineer in Europe (workatastartup.com)

1 points by syrusakbary posted 2 days ago

Kapa.ai (YC S23) is hiring AI research and full-stack roles (EU timezone) (ycombinator.com)

1 points by emil_sorensen posted 3 days ago

Ask HN: Who wants to be hired? (December 2024)

172 points by whoishiring posted 3 days ago • 424 comments

Evidence of the use of silk by Bronze Age civilization (nature.com)

163 points by geox posted 3 days ago • 64 comments

Show HN: Flow – A dynamic task engine for building AI agents (github.com)

158 points by skull8888888 posted 3 days ago • 50 comments

When was the famous "sudo warning" introduced? (2019) (retrocomputing.stackexchange.com)

157 points by Boogie_Man posted 4 days ago • 175 comments

Training myself to run farther with Strava's API and an IoT dog feeder of M&Ms (mayer.cool)

136 points by danielwmayer posted 4 days ago • 55 comments

Bioluminescent wood using the white rot fungus desarmillaria tabescens (onlinelibrary.wiley.com)

130 points by gnabgib posted 3 days ago • 26 comments

Unlocking the power of time-series data with multimodal models (research.google)

129 points by alach11 posted 3 days ago • 27 comments

KlongPy: High-Performance Array Programming in Python (github.com)

127 points by cl3misch posted 4 days ago • 78 comments

Demystifying Git Submodules (cyberdemon.org)

124 points by signa11 posted 4 days ago • 94 comments

Optimality of Gerver's Sofa (arxiv.org)

121 points by petters posted 3 days ago • 36 comments

Static IPs for Serverless Containers (modal.com)

121 points by ekzhang posted 3 days ago • 66 comments

Bicameral, Not Homoiconic (parentheticallyspeaking.org)

119 points by todsacerdoti posted 4 days ago • 64 comments

The zoology and biochemistry of xenomorphs from the Alien franchise (jgeekstudies.org)

117 points by zdw posted 3 days ago • 75 comments

The Rock VX Gas Canister Build (2022) (therpf.com)

117 points by 882542F3884314B posted 4 days ago • 56 comments

Show HN: Open-sourced (road) traffic counting application (github.com)

116 points by asfarley posted 3 days ago • 24 comments

The world of Dante's Divine Comedy (lithub.com)

114 points by lermontov posted 3 days ago • 69 comments

A federal policy change in the 1980s created the modern food desert (theatlantic.com)

92 points by zdw posted 3 days ago • 116 comments

A better approach to gravity: how we made EGM2008 faster (elodin.systems)

88 points by sphw posted 3 days ago • 23 comments

Neuroevolution of augmenting topologies (NEAT algorithm) (en.wikipedia.org)

87 points by elsewhen posted 3 days ago • 33 comments

US airlines transported passengers over two light-years since the last crash (ourworldindata.org)

87 points by sohkamyung posted 3 days ago • 121 comments

Meta built large-scale cryptographic monitoring (engineering.fb.com)

77 points by kiyanwang posted 4 days ago • 24 comments

CapibaraZero: A cheap alternative to FlipperZero based on ESP32-S3 (capibarazero.com)

69 points by andreock posted 3 days ago • 12 comments

Ask HN: I don't want to code anymore. What else can I do?

67 points by throwaway_43793 posted 3 days ago • 70 comments

President Biden pardons his son Hunter Biden (cnn.com)

66 points by LopRabbit posted 4 days ago • 75 comments

The Beautiful Math of Bloom Filters (nyadgar.com)

65 points by thunderbong posted 4 days ago • 20 comments

Modern cars are surveillance devices on wheels with major privacy risks (theconversation.com)

64 points by PaulHoule posted 4 days ago • 22 comments

Show HN: Automate your studio – mute a mixer channel to turn your PTZ camera (github.com)

63 points by kcsaba2 posted 3 days ago • 22 comments

An Aperiodic Monotile (2023) (cs.uwaterloo.ca)

59 points by phaedryx posted 4 days ago • 19 comments

ICP-Brasil: Mis-issued certificate (bugzilla.mozilla.org)

59 points by cipherboy posted 4 days ago • 10 comments

Vulkan Video Now Enabled by Default for Radeon VCN2/VCN3 Hardware on Linux (phoronix.com)

58 points by doener posted 3 days ago • 15 comments

Black Hole Puzzle (johncarlosbaez.wordpress.com)

49 points by besmirch posted 3 days ago • 51 comments

Amazon Workers on Strike from Black Friday to Cyber Monday (wfxrtv.com)

46 points by LinuxBender posted 4 days ago • 10 comments

Feds: Tether Has Become a Money Laundering Tool for Mexican Drug Trafficker (404media.co)

45 points by SirLJ posted 4 days ago • 21 comments

Dolphin Progress Release 2412 (dolphin-emu.org)

43 points by thepbone posted 3 days ago • 3 comments

Working with PaloAlto to identify CVE-2024-2550 (ac3.com.au)

41 points by lidder86 posted 4 days ago • 19 comments

Consciousness Might Hide in Our Brain's Electric Fields (scientificamerican.com)

40 points by thomasjudge posted 3 days ago • 34 comments

Show HN: Visualizing website carbon footprints using steam and robotics [video] (vimeo.com)

37 points by G_S posted 3 days ago • 8 comments

New physical AWS Data Transfer Terminals let you upload to the cloud faster (aws.amazon.com)

36 points by vinni2 posted 3 days ago • 36 comments

When a Telescope Is a National-Security Risk (theatlantic.com)

35 points by throw0101d posted 3 days ago • 19 comments

Big Endian's Guide to SQLite Storage (blog.jabid.in)

35 points by marcobambini posted 4 days ago

Atmospheric analysis shows Venus never had Earth-like life, scientists say (theguardian.com)

34 points by aguaviva posted 3 days ago • 17 comments

Try asking ChatGPT about "David Mayer"

34 points by calibas posted 4 days ago • 9 comments

FizzBuzz in Powerchords (tehruhn.github.io)

32 points by atemyipod posted 3 days ago • 5 comments

95 Tesla deaths have involved fires or Autopilot failures (businessinsider.com)

32 points by jrflowers posted 4 days ago • 8 comments

The First Geared CVT and It Will Blow Your Mind [video] (youtube.com)

31 points by chii posted 3 days ago • 9 comments

Why are doctors wary of wearables? (bbc.com)

30 points by NN88 posted 3 days ago • 36 comments

Claud Cockburn invented guerrilla journalism (jacobin.com)

30 points by mdp2021 posted 3 days ago • 6 comments

Musk's Rivals Fear He Will Target Them with His New Power (wsj.com)

30 points by perihelions posted 4 days ago • 7 comments

Falcon 9 reaches a flight rate 30 times higher than shuttle at 1/100th the cost (arstechnica.com)

27 points by rbanffy posted 3 days ago • 5 comments

ContainerScript: Firefox Addon for programmatically assigning URLs to containers (github.com)

27 points by 0x696C6961 posted 3 days ago • 24 comments

The FBI's WofMD Program Has a New Target: Animal Rights Activists (theintercept.com)

27 points by blueoysterbar posted 4 days ago • 26 comments

Pre-training a 15B parameter language model over the internet (distro.nousresearch.com)

26 points by modeless posted 3 days ago • 7 comments

Open-source OpenWrt One router released at $89 – 'hacker-friendly device' (tomshardware.com)

25 points by bhouston posted 3 days ago • 4 comments

I Was Wrong About Scrum, Again (rethinkingsoftware.substack.com)

24 points by aard posted 3 days ago • 4 comments

Getty Images CEO: Respecting fair use rules won't prevent AI from curing cancer (fortune.com)

24 points by benkan posted 3 days ago • 16 comments

Why Not Mars (2023) (idlewords.com)

24 points by simonebrunozzi posted 3 days ago • 37 comments

From PDFs to AI-ready structured data: a deep dive (explosion.ai)

23 points by will-burner posted 3 days ago

Show HN: SQL Simulator – Create Subsetted Databases in Docker or K8s (tribalknowledge.tech)

23 points by westonOG posted 3 days ago • 3 comments

Show HN: Akiradocs – open-source Documentation Framework with AI features (github.com)

21 points by sauravpanda posted 3 days ago • 3 comments

Mexican Cartels Lure Chemistry Students to Make Fentanyl (nytimes.com)

20 points by hilux posted 3 days ago • 3 comments

ChatGPT refuses to say one specific name "David Mayer" – and people are worried (independent.co.uk)

17 points by nabla9 posted 3 days ago • 9 comments

Fathom Analytics has been acquired (usefathom.com)

17 points by charlieirish posted 3 days ago • 2 comments

Communication Structures in a Growing Organization (jessitron.com)

17 points by BerislavLopac posted 3 days ago

Apple Illegally Surveilled and Censored Workers, Employee Lawsuit Says (gizmodo.com)

15 points by pseudolus posted 3 days ago • 2 comments

Tempest Anderson: Pioneer of Volcano Photography (2015) (publicdomainreview.org)

15 points by ulrischa posted 3 days ago • 1 comments

Announcing OpenBao v2.1.0 - OSI-licensed fork of HashiCorp Vault (openbao.org)

15 points by cipherboy posted 3 days ago • 1 comments

Windows 11 market share declines as users seemingly shift back to Windows 10 (tomshardware.com)

15 points by MRPockets posted 3 days ago • 3 comments

Axis 3D Printer with Radial Non-Planar Slicer – Joshua Bird [video] (youtube.com)

15 points by WillDaSilva posted 3 days ago • 1 comments

There's a real math problem with MicroStrategy's obscene valuation premium (sherwood.news)

14 points by SirLJ posted 4 days ago • 4 comments

Tesla CEO Elon Musk loses bid to get $56B pay package reinstated (cnbc.com)

13 points by PLenz posted 3 days ago

Holocaust survivors seek right to sue for compensation of seized property (amylhowe.com)

12 points by speckx posted 3 days ago

The Art of Failure Analysis 2024 (spectrum.ieee.org)

12 points by rbanffy posted 3 days ago • 2 comments

A Declaration of the Independence of Cyberspace (eff.org)

12 points by Khaine posted 3 days ago • 4 comments

Employee sues Apple over 'spying' claims tied to mandatory devices (theregister.com)

11 points by defrost posted 3 days ago

CJIT – C, Just in Time (dyne.org)

11 points by sharjeelsayed posted 3 days ago

Positioning single atoms with a scanning tunnelling microscope (1990) (nature.com)

11 points by sandwichsphinx posted 3 days ago • 1 comments

Blizzard is delisting the OG Warcrafts from GOG (pcgamer.com)

11 points by ortusdux posted 3 days ago

The Two Big Games (overcomingbias.com)

11 points by jger15 posted 3 days ago • 2 comments

GOG's preservation program lets you keep playing games after they're delisted (theverge.com)

10 points by Shank posted 3 days ago

New funding could make whole-eye transplants a reality (news.northwestern.edu)

10 points by gnabgib posted 3 days ago

Georgia's moment of truth: Protesters demand Western path not Russian past (bbc.com)

10 points by peutetre posted 3 days ago • 3 comments

Elon Musk's $50B Tesla Pay Can't Be Reinstated, Delaware Judge Rules (nytimes.com)

10 points by falcor84 posted 3 days ago

Show HN: Convert your text or CSV to infographics to 10x the engagement (chartsnotchapters.com)

10 points by lyogavin posted 3 days ago • 1 comments

1Password Joins the Rails Foundation (blog.1password.com)

10 points by terracatta posted 3 days ago

I Want an Honest Office (schistad.net)

10 points by hucker posted 3 days ago • 8 comments

Patched AppKit in Mac OS X 10.0 to re-enable the NeXTSTEP interface style (2022) (mastodon.social)

10 points by robin_reala posted 3 days ago

Natural soundscapes enhance mood recovery amid anthropogenic noise pollution (journals.plos.org)

9 points by domofutu posted 3 days ago • 3 comments

When a Telescope Is a National-Security Risk (msn.com)

9 points by pnw posted 3 days ago • 3 comments

Enron is back to launch crypto token focused on solving the energy crisis (cryptoslate.com)

9 points by RyeCombinator posted 3 days ago • 4 comments

Raspberry Pi boosts Pi 5 performance with SDRAM tuning (jeffgeerling.com)

9 points by speckx posted 3 days ago

Carbon dioxide capture from open air using covalent organic frameworks (nature.com)

9 points by the-chitmonger posted 3 days ago • 26 comments

Compiling Lisp to Bytecode and Running It (healeycodes.com)

9 points by ingve posted 3 days ago • 1 comments

Vietnamese tycoon in race to raise $9B to avoid execution (bbc.com)

8 points by peutetre posted 3 days ago

Blended Wing Body Passenger Airplanes and the End of Winged Tubes (hackaday.com)

8 points by rolph posted 3 days ago

Putin approves record defense spending – a third of Russia's budget (cnn.com)

8 points by peutetre posted 3 days ago • 2 comments

Americans want a second passport and are willing to pay (sherwood.news)

8 points by rwmj posted 3 days ago

Banana Pi OpenWrt One Router (docs.banana-pi.org)

8 points by micheljansen posted 3 days ago • 1 comments

Nvidia claims a new AI audio generator can make sounds never heard before (theverge.com)

8 points by benkan posted 3 days ago • 1 comments

ASML made a $230 Lego kit version of its $380M semiconductor tool (tomshardware.com)

8 points by gradus_ad posted 3 days ago • 2 comments

Legacy Safety: The Wrocław C++ Meeting (cor3ntin.github.io)

8 points by steveklabnik posted 3 days ago

Vulkan 1.4 Streamlines Development, Deployment of GPU-Accelerated Applications (khronos.org)

8 points by jlpcsl posted 3 days ago

Dia Browser (diabrowser.com)

8 points by hasheddan posted 3 days ago • 3 comments

Windows 11 market share falls despite Microsoft ad blitz (theregister.com)

8 points by rntn posted 3 days ago • 4 comments

Tech Companies Are Awash in 'Ghost Engineers,' Researcher Says (businessinsider.com)

8 points by rbanffy posted 3 days ago • 6 comments

Manifesto from Prisma on next steps with the ORM (prisma.io)

8 points by gniting posted 3 days ago • 6 comments

House Covid Committee Final Covid-19 Most Likely Emerged from Wuhan Lab [pdf] (oversight.house.gov)

7 points by ibaikov posted 3 days ago

Judge confirms decision to sink Musk's $56B package despite shareholder vote (techcrunch.com)

7 points by coloneltcb posted 3 days ago

Musk Record Tesla Pay Plan Rejected Again by Delaware Judge (news.bloomberglaw.com)

7 points by antimora posted 3 days ago

UK counter-terrorism unit demands ban on pro-Palestinian shooter (gamesindustry.biz)

7 points by gslin posted 3 days ago

Scientists baffled as orcas seem to revive an 80s trend: dead salmon hats (theguardian.com)

7 points by rntn posted 3 days ago • 1 comments

Open source router firmware project OpenWrt ships its own repairable hardware (theregister.com)

7 points by nileshtrivedi posted 3 days ago

Treating wounds in pediatrics with medical grade honey: A case series (pubmed.ncbi.nlm.nih.gov)

7 points by atmosx posted 3 days ago • 2 comments

Sales of Bibles Are Booming, Fueled by First-Time Buyers and New Versions (wsj.com)

7 points by paulpauper posted 3 days ago • 4 comments

Durable all inorganic perovskite tandem photovoltaics – Nature (nature.com)

7 points by rbanffy posted 3 days ago • 1 comments

AGI requires better retrieval, not just better LLMs. Here's why (medium.com)

7 points by ghita_ posted 3 days ago

The Honeywell Kitchen Computer: The 1960s Meal Planner That Nobody Could Afford (rarehistoricalphotos.com)

7 points by mamoul posted 3 days ago

Mathematics, Philosophy, and Artificial Intelligence (giancarlorota.org)

7 points by sourcepluck posted 3 days ago • 1 comments

I've worked in SF, Chicago, and Silicon Valley. I'd only raise my family in one (businessinsider.com)

7 points by binarynate posted 4 days ago • 6 comments

Oxford Electric Bell (en.wikipedia.org)

7 points by thunderbong posted 4 days ago

Vietnamese tycoon in race to raise $9B to avoid execution (bbc.co.uk)

6 points by jzox posted 3 days ago

Website Shows How Much Google's AI Can Glean from Your Photos (wired.com)

6 points by sweca posted 3 days ago

Stephen King shuts down money-losing radio stations after 40 years (bangordailynews.com)

6 points by ilamont posted 3 days ago

Trump may cancel NASA's powerful SLS Moon rocket – here's what that would mean (theconversation.com)

6 points by amichail posted 3 days ago

What happens to your body when you take a sip of coffee (telegraph.co.uk)

6 points by domofutu posted 3 days ago

Breakout in Decker, Three Ways (beyondloom.com)

6 points by todsacerdoti posted 3 days ago

Large Language Model-Brained GUI Agents: A Survey (arxiv.org)

6 points by pongogogo posted 3 days ago

Apple accused of snooping on workers' iPhones in new lawsuit (theverge.com)

6 points by hampus posted 3 days ago

PicoCAD – Steam release retrospect – wishlist and sales data (patreon.com)

6 points by nopakos posted 3 days ago

Warcraft 1+2 will be delisted from GOG (gog.com)

6 points by TiredOfLife posted 3 days ago

The CIA, NSA, and Pokémon Go (lunduke.locals.com)

6 points by cristaloleg posted 3 days ago

The Weird-but-True Story Behind Denver Airport's Scary Horse Statue (2020) (fodors.com)

6 points by mooreds posted 3 days ago

Elon Musk Rehires Entire Supercharger Team After Firing Them (glassalmanac.com)

6 points by Tomte posted 4 days ago • 3 comments

The graduation problem: avoid frameworks getting in the way (blog.dagworks.io)

5 points by krawczstef posted 3 days ago • 1 comments

China Became the Largest Car Exporter (nytimes.com)

5 points by surprisetalk posted 3 days ago • 1 comments

California can't use all its solar power. That's a problem (sfgate.com)

5 points by robg posted 3 days ago • 1 comments

Judge reaffirms ruling that invalidated Tesla pay package for Elon Musk (apnews.com)

5 points by c420 posted 3 days ago

The hunt for heat: Drilling the deepest holes on Earth (bbc.com)

5 points by rmason posted 3 days ago

BootKitty UEFI malware exploits LogoFAIL to infect Linux systems (bleepingcomputer.com)

5 points by sandwichsphinx posted 3 days ago

Compilation on the GPU? A Feasibility Study (2022) (dl.acm.org)

5 points by fanf2 posted 3 days ago

DuckDB is faster at counting the lines of a CSV file than wc (twitter.com)

5 points by tosh posted 3 days ago • 3 comments

How Libra Was Killed (threadreaderapp.com)

5 points by yarapavan posted 3 days ago • 1 comments

Orion browser silently pings page's previously opened links for no reason

5 points by fimbulfamb posted 3 days ago • 3 comments

Colt's Revolutions (taylor.town)

5 points by surprisetalk posted 3 days ago • 1 comments

Inhaling Hydrogen-Rich Gas Before Acute Exercise Alleviates Exercise Fatigue (thieme-connect.de)

5 points by bookofjoe posted 3 days ago • 1 comments

Employee lawsuit accuses Apple of spying on its workers (semafor.com)

5 points by jmsflknr posted 3 days ago

eInk Picture Frames (paperlesspaper.de)

5 points by Utzel-Butzel posted 3 days ago • 1 comments

OpenAI explores advertising as it steps up revenue drive (ft.com)

5 points by openrisk posted 3 days ago • 1 comments

Python type hints are probably "worth it" in the large for me (utcc.utoronto.ca)

5 points by ingve posted 3 days ago

Arch Linux installer now slightly less masochistic (theregister.com)

5 points by ossusermivami posted 3 days ago

Photonic processor could enable fast AI computations with energy efficiency (news.mit.edu)

4 points by gnabgib posted 3 days ago

Elon Musk files for injunction to halt OpenAI's transition to a for-profit (techcrunch.com)

4 points by croes posted 3 days ago

Some Simple Economics of the Google Antitrust Case (marginalrevolution.com)

4 points by ano-ther posted 3 days ago

Once (once.com)

4 points by guerrilla posted 3 days ago • 2 comments

I think the donation notification works (pointieststick.com)

4 points by TangerineDream posted 3 days ago

Helsing at Eurorust and the Oxidation of Defense (cafkafk.dev)

3 points by mansard posted 3 days ago

DENT: An Open-Source Linux-Based Network Operating System (dent.dev)

3 points by teleforce posted 3 days ago

Oil giants blocked a treaty to curb plastic pollution; countries will try again (theverge.com)

3 points by rntn posted 3 days ago

Building a minimalist native Python desktop application with Pyloid and Gradio (github.com)

3 points by knowsuchagency posted 3 days ago

Congressional subcommittee: Covid 'most likely' leaked from Wuhan lab (foxnews.com)

3 points by donsupreme posted 3 days ago

Vasily Arkhipov (en.wikipedia.org)

3 points by tempestn posted 3 days ago

New open source 4-axis non-planar 3D printer [video] (youtube.com)

3 points by ComputerGuru posted 3 days ago

HPE Slingshot 400 Brings a Liquid Cooled 51.2T Switch and 400Gbps Networking (servethehome.com)

3 points by PaulHoule posted 3 days ago

How do I pay the publisher of a web page? (sethmlarson.dev)

3 points by surprisetalk posted 3 days ago • 1 comments

Project Orion (Nuclear Propulsion) (en.wikipedia.org)

3 points by simonebrunozzi posted 3 days ago

European Federation of Journalists to stop posting content on X (Twitter) (thelondoneconomic.com)

3 points by latexr posted 3 days ago

Conventional Commit Messages (gist.github.com)

3 points by t55 posted 3 days ago • 2 comments

UN plastic treaty talks end without a deal (politico.eu)

3 points by pseudolus posted 3 days ago

SQLite Index Visualization: Search (mrsuh.com)

3 points by mrsuh posted 3 days ago

Tesla has been slow to make its chargers accessible to other EVs (financialpost.com)

3 points by MilnerRoute posted 4 days ago • 1 comments

Debugging a Superblock Percpu_rw_semaphore Deadlock (rustylife.github.io)

3 points by rustylife posted 4 days ago

Gene behind orange fur in cats (science.org)

220 points by rbanffy posted 4 days ago • 133 comments

Kyawthuite is so rare it's only ever been found once (sciencealert.com)

216 points by pseudolus posted 4 days ago • 96 comments

Handwriting but not typewriting leads to widespread connectivity in brain (openread.academy)

211 points by cryptozeus posted 4 days ago • 125 comments